SEED SOWER
Pending Patents Published December 19-26, 2024
Welcome to the weekly edition of Seed Sower, which shares a list of pending patents published the previous week by the U.S. Patent and Trademark Office. These patent applications cover seed-bearing plants and non-transgenic plant breeding methods only.
The USDA Seed Liaison helps those who work with seeds to navigate a complex system by increasing transparency about intellectual property related to seeds, among other things. Learn more about the Seed Liaison initiative.
KIT HAVING ACTIVE POLYMER MATERIALS FOR GROWING MORE VIGOROUS, LARGER, AND HEALTHIER PLANTS
METHODS AND COMPOSITIONS FOR PRODUCING CLONAL, NON-REDUCED, NON-RECOMBINED GAMETES
METHODS AND COMPOSITIONS FOR RNA-DIRECTED TARGET DNA MODIFICATION AND FOR RNA-DIRECTED MODULATION OF TRANSCRIPTION
GENERATION OF HAPLOID PLANTS
ENVIRONMENTAL-FRIENDLY AND EFFICIENT BREEDING METHOD OF HIGH-YIELD AND HIGH-QUALITY WHEAT CULTIVARS
METHODS FOR GENETIC ANALYSIS OF TEXTILES COMPRISING G. BARBADENSE
NOVEL MARKERS COMBINATION IN SWEET BASIL FOR DISEASE RESISTANCES
TOMATO PLANT PRODUCING FRUITS WITH MODIFIED SUGAR CONTENT
EUSTOMA PLANT WITH EUSTOMA FUSARIUM WILT RESISTANCE
BRASSICA RAPA VAR NIPPOSINICA NAMED MAZUNTE
HYBRID CORN PLANT AND SEED A5000
MARIGOLD MALE INBRED LINE DENOMINATED KI3928
POTATO VARIETY NAMED 'UNR-01'
RICE CULTIVAR CLM05
CRAB APPLE TREE NAMED 'B17CRAB7'
This list includes the titles of all U.S. patent applications published between December 19-26, 2024 with the following Cooperative Plant Classification:
A01H: New plants or {non-transgenic} processes for obtaining them; plant reproduction by tissue culture techniques | 6: Angiosperms, i.e. Flowering plants, characterised by their botanic taxonomy
Patents can have more than one classification. There may be other classifications of interest to plant breeders. View all classifications for A01H.
To assist the reader in understanding each patent application, each title below is followed by the application's abstract and its independent claims.
The abstract is a short summary of the invention that allows the reader to understand the gist of disclosed invention. Independent (standalone) claims define the scope of the patent protection being sought. Independent claims may also be followed by one or more dependent claims, which are not listed here in the interest of brevity. To see the application’s complete list of claims:
- Click the patent title to open the application in Patent Center.
- Click “Download PDF.”
- Find the numbered list of claims, usually located at the end of the document.
Some applications are excluded from Pre-Grant Publication. Those applications include: applications recognized by the Office as no longer pending; applications that are national security classified (see 37 CFR 5.2(c)), subject to a secrecy order under 35 U.S.C. 181, or under national security review; applications that have been issued as a patent in sufficient time to be removed from the publication process; and applications filed with a nonpublication request in compliance with 37 CFR 1.213(a). See MPEP § 1122-1124.
Members of the public have the option of filing third party submissions of prior art to pending patent applications. Prior art may be any evidence that what is claimed in the patent application has already been publicly described. Learn more about third party preissuance submissions.
The Seed Liaison welcomes your feedback, questions, and concerns at seedliaison@usda.gov.
KIT HAVING ACTIVE POLYMER MATERIALS FOR GROWING MORE VIGOROUS, LARGER, AND HEALTHIER PLANTS
Applicants: Hologenix LLC
Abstract: The present invention provides compositions, kits and methods for growing more vigorous, larger and healthier plants, including from clone cuttings.
Independent claims:
1. A kit, comprising: a plant, wherein at least one portion of the plant is contained by one or more of a bag or a pot filled with growth media; and an active polymer comprising one or more minerals suspended, embedded, or otherwise incorporated in a polymer matrix, wherein the active polymer is operable to absorb light, convert the absorbed light into infrared light, and emit the infrared light, and wherein the one or more minerals are selected from the group consisting of silicon carbide (SiC), calcium carbide (CaC.sub.2), titanium dioxide (TiO.sub.2), aluminum oxide (Al.sub.2O.sub.3), and silicon dioxide (SiO.sub.2), wherein the active polymer forms the one or more of the bag or the pot, and wherein the plant exhibits improved growth compared to a control plant grown without the active polymer.
10. A kit comprising: a plant, wherein at least one portion of the plant is contained by one or more of a bag or a pot filled with growth media; and an active polymer comprising one or more minerals suspended, embedded, or otherwise incorporated in a polymer matrix, wherein the one or more minerals comprises silicon carbide present in a ratio of greater than or equal to 3:2.
16. A kit, comprising: an active polymer comprising one or more minerals suspended, embedded, or otherwise incorporated in a polymer matrix, wherein the one or more minerals comprises silicon carbide present in a ratio of greater than or equal to 3:2; a growth media; and a plant, wherein at least one part of the active polymer touches the plant, and wherein the plant exhibits improved growth compared to a control plant grown without the active polymer.
METHODS AND COMPOSITIONS FOR PRODUCING CLONAL, NON-REDUCED, NON-RECOMBINED GAMETES
Applicants: PIONEER HI-BRED INTERNATIONAL, INC.; CORTEVA AGRISCIENCE LLC
Abstract: Methods and compositions useful for avoiding plant meiosis and clonal reproduction through seed are provided herein. The present disclosure provides polynucleotides and related polypeptides of Spo11, Rec8, OSD1-1A, and OSD1-3A and methods and compositions for suppressing their expression level or activity.
Independent claims:
33. A method for obtaining a maize plant cell with a modified endogenous Rec8 polynucleotide sequence, the method comprising: a) introducing a genetic modification into an endogenous Rec8 polynucleotide sequence in a maize plant cell, wherein the genetic modification disrupts the orientation of kinetochores and subsequent random distribution of chromatids during meiosis II in the maize plant cell, wherein the endogenous Rec8 polynucleotide comprises: i. a polynucleotide that encodes the polypeptide of SEQ ID NO:12, ii. a polynucleotide comprising the sequence set forth in SEQ ID NO:9, 10, 11 or 20; or iii. a polynucleotide having at least 80% sequence identity to SEQ ID NO: 9, 10, 11 or 20; and a) obtaining a maize plant cell having the modified endogenous Rec8 polynucleotide sequence.
49. A maize plant comprising a modified endogenous Rec8 polynucleotide sequence, wherein the maize plant comprises an introduced genetic modification into an endogenous Rec8 polynucleotide sequence, wherein the endogenous Rec8 polynucleotide comprises: i. a polynucleotide that encodes the polypeptide of SEQ ID NO:12, ii. a polynucleotide comprising the sequence set forth in SEQ ID NO:9, 10, 11 or 20; or iii. a polynucleotide having at least 80% sequence identity to SEQ ID NO: 9, 10, 11 or 20.
METHODS AND COMPOSITIONS FOR RNA-DIRECTED TARGET DNA MODIFICATION AND FOR RNA-DIRECTED MODULATION OF TRANSCRIPTION
Applicants: The Regents of the University of California; University of Vienna; Emmanuelle Charpentier
Abstract: The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
Independent claims:
1. A single-molecule DNA-targeting UNA having the structure: ##STR00001## wherein the linker is GAAA and the nucleotide sequence of the single-molecule DNA-targeting RNA is GAUUUCUUCUUGCGCUUUUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 321).
2. A method of cleaving a target DNA, the method comprising: contacting a target DNA with a complex comprising: (a) the single molecule DNA-targeting RNA of claim 1; and (b) a Cas9 protein comprising the pyogenes Cas9 amino acid sequence set forth as SEQ ID NO.: 2, wherein prior to said contacting the target DNA is double stranded and comprises a nucleotide sequence taatgaattccccaatacecaaaaacgcaagaagaaatcaaccagcgca (SEQ ID NO: 302) hybridized to a nucleotide sequence tgegctggttgatttcttettgegctttttgggtattggggaattcatta (SEQ ID NO: 301), wherein said contacting is in vitro and does not take place inside of a cell, and wherein the method results in cleavage of the target DNA.
GENERATION OF HAPLOID PLANTS
Applicants: KWS SAAT SE & Co. KGaA
Abstract: The present invention relates to non-transgenic and transgenic plants, preferably crop plants, having biological activity of a haploid inducer and comprising a polynucleotide which comprises a nucleotide sequence encoding a centromer histone H3 (CENH3) protein, wherein the polynucleotide comprises at least one mutation causing an alteration of the amino acid sequence of the CENH3 protein, and to a part of the part. Further, the invention provides methods of generating the inducer plants, methods of generating haploid and double haploid plants using the inducer plants as well as methods of facilitating cytoplasm exchange.
Independent claims:
17. A plant having a biological activity of a haploid inducer and comprising a polynucleotide which comprises a nucleotide sequence encoding a centromeric histone H3 (CENH3) protein, wherein the nucleotide sequence comprises at least one introduced mutation that alters the amino acid sequence of the CENH3 protein in an α2-helix.
33. A polynucleotide comprising a nucleotide sequence encoding at least one segment of the amino acid sequence of CENH3, wherein the polynucleotide comprises at least one mutation causing an alteration of the amino acid sequence of the at least one segment, wherein the at least one segment is an α2-helix corresponding to nucleotides from position 379 to position 465 set forth in SEQ ID NO: 10 of the CENH3 protein derived from Arabidopsis thaliana set forth in SEQ ID NO: 11.
ENVIRONMENTAL-FRIENDLY AND EFFICIENT BREEDING METHOD OF HIGH-YIELD AND HIGH-QUALITY WHEAT CULTIVARS
Applicants: Crop Research Institute, SAAS
Abstract: The present disclosure relates to the technical field of breeding, in particular to an environmental-friendly and efficient breeding method of high-yield and high-quality wheat cultivars. In the present disclosure, the breeding method can improve a breeding efficiency of excellent new cultivars, further realize large-scale production, and further increase a planting area of the excellent cultivars. In addition, the breeding method can increase the number of products for the new cultivars, further increase a diversity of early-generation materials, and further increase a diversity of hybrid samples through the innovation of hybridization and breeding methods. The environmental-friendly and efficient breeding method of high-yield and high-quality wheat cultivars can increase a richness of excellent characteristics of the new cultivars through high-generation materials, hybridization, and off-site identification, thereby further improving an effect of breeding.
Independent claim:
1. An environmental-friendly and efficient breeding method of high-yield and high-quality wheat cultivars, comprising the following steps: 1) screening or preparing a breeding material according to a breeding objective; wherein traits of the breeding objective comprise one or more of super strong gluten, high-quality strong gluten, high-quality medium gluten, a high yield, a high water and fertilizer efficiency, disease resistance and stress resistance, a waxy property, and a high-resistant starch; when the traits of the breeding objective comprise the super strong gluten or the high-quality strong gluten, traits of the breeding material comprise: a grain protein dry-basis content of greater than or equal to 14.0%, a wet gluten content of 14% wet-basis flour of greater than or equal to 31%, a gluten index of greater than or equal to 80%, a Zeleny sedimentation value of greater than or equal to 42 ml, a dough water absorption of greater than or equal to 62%, a stability time of greater than or equal to 12 min, a tensile area of greater than or equal to 100 cm.sup.2, maximum resistance to extension of greater than or equal to 450 EU, an extensibility of greater than or equal to 160 mm, a loaf volume of greater than or equal to 850 mL, agronomic traits better than or equal to those of a high-yield control, and a yield greater than or equal to 10% of that of the high-yield control; when the traits of the breeding objective comprise the high-quality medium gluten, the traits of the breeding material comprise: a grain protein dry-basis content of greater than or equal to 13.5%, a wet gluten content of 14% wet-basis flour of greater than or equal to 30%, a Zeleny sedimentation value of greater than or equal to 40 ml, a dough water absorption of greater than or equal to 60%, a stability time of greater than or equal to 5 min, a sensory score of noodles or steamed buns of greater than or equal to 85, agronomic traits equal to those of a high-yield control, and a yield greater than that of the high-yield control; when the traits of the breeding objective comprise the high yield, the traits of the breeding material comprise: comprehensive traits better than those of a local dominant cultivar and a yield greater than or equal to 5% higher than that of the local dominant cultivar; when the traits of the breeding objective comprise the disease resistance, the traits of the breeding material comprise: resistance to two or more major local diseases, better agronomic traits, and a yield greater than or equal to that of a high-yield control; when the traits of the breeding objective comprise the high water and fertilizer efficiency and the stress resistance, the traits of the breeding materials comprise: comprehensive traits better than those of a local dominant cultivar, a yield greater than or equal to 5% higher than that of the local dominant cultivar, a water saving index of greater than or equal to 1.2, drought resistance of greater than or equal to 2, a nitrogen use efficiency of greater than or equal to 1.3, or a phosphorus use efficiency of greater than or equal to 1.1; when the traits of the breeding objective comprise the waxy property, the traits of the breeding material comprise: an amylose content of less than 1%, an amylopectin content of greater than or equal to 99%, better agronomic traits, and a yield greater than or equal to 10% of that of a high-yield control; and when the traits of the breeding objective comprise the high-resistant starch, the traits of the breeding material comprise: a resistant starch content of greater than 5.0%; 2) configuring a hybrid combination for the breeding material according to the breeding objective, and conducting hybridization to obtain an early-generation material; and 3) conducting selfing on the early-generation material for not less than five generations, and selecting high-yield and high-quality new wheat cultivars; wherein the new wheat cultivars and selection criteria thereof comprise one or more of the following items: wheat with super strong gluten meeting the following criteria: a grain protein dry-basis content of greater than or equal to 14.5%, a wet gluten content of 14% wet-basis flour of greater than or equal to 33%, a gluten index of greater than or equal to 90%, a Zeleny sedimentation value of greater than or equal to 45 ml, a dough water absorption of greater than or equal to 63%, a stability time of greater than or equal to 15 min, a tensile area of greater than or equal to 110 cm.sup.2, maximum resistance to extension of greater than or equal to 500 EU, an extensibility of greater than or equal to 170 mm, and a yield greater than or equal to 5% of that of a local dominant cultivar; wheat with a high yield and high-quality strong gluten meeting the following criteria: a grain protein dry-basis content of greater than or equal to 14.0%, a wet gluten content of 14% wet-basis flour of greater than or equal to 31%, a gluten index of greater than or equal to 80%, a Zeleny sedimentation value of greater than or equal to 42 ml, a dough water absorption of greater than or equal to 62%, a stability time of greater than or equal to 12 min, a tensile area of greater than or equal to 100 cm.sup.2, maximum resistance to extension of greater than or equal to 450 EU, an extensibility of greater than or equal to 160 mm, a loaf volume of greater than or equal to 800 mL, a loaf sensory score of greater than or equal to 80, and a yield greater than or equal to 5% of that of a local dominant cultivar; wheat with a high yield and high-quality medium gluten meeting the following criteria: a grain protein dry-basis content of greater than or equal to 13.5%, a wet gluten content of 14% wet-basis flour of greater than or equal to 30%, a Zeleny sedimentation value of greater than or equal to 40 ml, a dough water absorption of greater than or equal to 60%, a stability time of greater than or equal to 5 min, a sensory score of noodles or steamed buns of greater than or equal to 85, and a yield of greater than or equal to that of a local dominant cultivar; wheat with a high yield meeting the following criteria: a yield greater than or equal to 5% higher than that of a local dominant cultivar and a yield increase pilot rate of greater than or equal to 60%; wheat with a high yield and disease resistance meeting the following criteria: resistance to two or more major local diseases and a yield greater than or equal to that of a local dominant cultivar; wheat with a high water and fertilizer efficiency and stress resistance meeting the following criteria: a yield greater than or equal to 5% higher than that of a local dominant cultivar, a yield increase pilot rate of greater than or equal to 60%, a water saving index of greater than or equal to 1.2 for a water-saving cultivar, drought resistance of greater than or equal to level 2 for a drought-resistance cultivar, a nitrogen use efficiency of greater than or equal to 1.3 for a nitrogen-efficient cultivar, or a phosphorus use efficiency of greater than or equal to 1.1 for a phosphorus-efficient cultivar; wheat with a waxy property meeting the following criteria: an amylose content of less than 2%, an amylopectin content of greater than or equal to 98%, and a yield greater than or equal to 5% higher than that of a local dominant cultivar; and wheat with a high-resistant starch meeting the following criteria: a resistant starch content of greater than 4.0% and a yield greater than or equal to 5% higher than that of a local dominant cultivar.
METHODS FOR GENETIC ANALYSIS OF TEXTILES COMPRISING G. BARBADENSE
Applicants: Applied DNA Sciences, Inc.
Abstract: The present invention provides a method for determining whether a mature cotton fiber includes Giza 94 (G94) variety of G. barbadense. The method comprises providing a mature cotton fiber from a manufactured article; extracting DNA from the mature cotton fiber; amplifying a portion of said DNA with a PCR-based technique using a primer set comprising SEQ ID NO: 1 and SEQ ID NO: 2, thereby producing one or more amplicons, generating a variable amplicon length polymorphism profile (VALP) from the amplicons, and comparing the generated VALP with a G94 variable amplicon length polymorphism profile, thereby determining whether the mature cotton fiber incudes G94.
Independent claims:
1. A method for determining whether a mature cotton fiber includes Giza 94 (G94) variety of barbadense, the method comprising: providing a mature cotton fiber from a manufactured article; extracting DNA from the mature cotton fiber; amplifying a portion of said DNA with a PCR-based technique using a primer set comprising SEQ ID NO: 1 and SEQ ID NO: 2, thereby producing one or more amplicons, generating a variable amplicon length polymorphism profile (VALP) from the amplicons, and comparing the generated VALP with a G94 variable amplicon length polymorphism profile, thereby determining whether the mature cotton fiber incudes G94.
15. A method for verifying authenticity of the variety of barbadense of a mature cotton fiber as including a fiber from G94, wherein the mature cotton fiber is from a manufactured article, the method comprising: providing a mature cotton fiber from the manufactured article; extracting DNA from the mature cotton fiber; amplifying a portion of said DNA with a PCR-based technique using a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2, thereby producing one or more amplicons, generating a variable amplicon length polymorphism profile (VALP) from the amplicons, and comparing the generated VALP with a G94 variable amplicon length polymorphism profile, thereby verifying the authenticity of the mature cotton fiber from the manufactured article as including a fiber from G94.
16. A kit for determining whether a mature cotton fiber includes Giza 94 (G94) variety of barbadense, the kit comprising at least one primer set comprising SEQ ID NO: 1 and SEQ ID NO: 2.
NOVEL MARKERS COMBINATION IN SWEET BASIL FOR DISEASE RESISTANCES
*Response to Non-Final Office Action Entered and Forwarded to Examiner*
Applicants: BAR-ILAN UNIVERSITY
Abstract: The present invention discloses a disease resistant cultivated basil plant and/or seed comprising a genomic sequence having an introgressed basil downy mildew (BDM) resistance or tolerance associated haplotype derived from Ocimum americanum. A method for producing the same is also disclosed.
Independent claims:
1. A disease resistant cultivated basil plant and/or seed, wherein said basil plant and/or seed comprises a genomic sequence having an introgressed basil downy mildew (BDM) resistance or tolerance associated haplotype, said haplotype is derived from Ocimum americanum or any hybrid thereof and comprises at least one of: a single nucleotide polymorphism (SNP) of nucleotide T at position 7 of a sequence comprising at least 80% identity to SEQ ID NO:1, SNP of nucleotide A at position 5 of a sequence comprising at least 80% identity to SEQ ID NO:2, SNP of nucleotide C at position 48 of a sequence comprising at least 80% identity to SEQ ID NO:3, SNP of nucleotide G at position 4 of a sequence comprising at least 80% identity to SEQ ID NO:4, SNP of nucleotide T at position 19 of a sequence comprising at least 80% identity to SEQ ID NO:5, SNP of nucleotide A at position 8 of a sequence comprising at least 80% identity to SEQ ID NO:6, SNP of nucleotide T at position 29 of a sequence comprising at least 80% identity to SEQ ID NO:7, SNP of nucleotide T at position 55 of a sequence comprising at least 80% identity to SEQ ID NO:8, SNP of nucleotide T at position 41 of a sequence comprising at least 80% identity to SEQ ID NO:9, SNP of nucleotide C at position 11 of a sequence comprising at least 80% identity to SEQ ID NO:10, SNP of nucleotide G at position 6 of a sequence comprising at least 80% identity to SEQ ID NO:11 or any combination thereof.
23. A method for producing a disease resistant cultivated basil plant and/or seed, the method comprising: a. selecting a first Ocimum americanum basil plant exhibiting resistance or tolerance to basil downy mildew (BDM) race-0 and comprising a haplotype associated with the BDM race-0 resistance or tolerance; and/or selecting a second Ocimum americanum basil plant exhibiting resistance or tolerance to basil downy mildew (BDM) race-1 and comprising a haplotype associated with the BDM race 1 resistance or tolerance; b. crossing the first and/or the second BDM resistant or tolerant basil plant with a basil plant lacking BDM resistance or tolerance, to produce F1 basil progeny plants; c. optionally backcrossing the F1 plants with the BDM nonresistant basil plant; and d. selecting a basil plant having resistance to BDM race-0 and/or BDM race-1, wherein the BDM resistant or tolerant basil plant has introgressed into its genome the haplotype associated with the resistance to BDM race-0 and/or race-1, wherein said BDM resistance or tolerance associated haplotype comprises at least one of: a single nucleotide polymorphism (SNP) of nucleotide T at position 7 of a sequence comprising at least 80% identity to SEQ ID NO:1, SNP of nucleotide A at position 5 of a sequence comprising at least 80% identity to SEQ ID NO:2, SNP of nucleotide C at position 48 of a sequence comprising at least 80% identity to SEQ ID NO:3, SNP of nucleotide G at position 4 of a sequence comprising at least 80% identity to SEQ ID NO:4, SNP of nucleotide T at position 19 of a sequence comprising at least 80% identity to SEQ ID NO:5, SNP of nucleotide A at position 8 of a sequence comprising at least 80% identity to SEQ ID NO:6, SNP of nucleotide T at position 29 of a sequence comprising at least 80% identity to SEQ ID NO:7, SNP of nucleotide T at position 55 of a sequence comprising at least 80% identity to SEQ ID NO:8, SNP of nucleotide T at position 41 of a sequence comprising at least 80% identity to SEQ ID NO:9, SNP of nucleotide C at position 11 of a sequence comprising at least 80% identity to SEQ ID NO:10, SNP of nucleotide G at position 6 of a sequence comprising at least 80% identity to SEQ ID NO:11 or any combination thereof.
42. An allele, haplotype, molecular marker or genetic determinant being inherited to progeny plant, wherein said allele, haplotype, molecular marker or genetic determinant is associated with resistance or tolerance to BDM race-0 or to BDM race-1, wherein said allele, haplotype, molecular marker or genetic determinant is selected from: a. a single nucleotide polymorphism (SNP) of nucleotide T at position 7 of a sequence comprising at least 80% identity to SEQ ID NO:1, SNP of nucleotide A at position 5 of a sequence comprising at least 80% identity to SEQ ID NO:2, SNP of nucleotide C at position 48 of a sequence comprising at least 80% identity to SEQ ID NO:3, SNP of nucleotide G at position 4 of a sequence comprising at least 80% identity to SEQ ID NO:4, SNP of nucleotide T at position 19 of a sequence comprising at least 80% identity to SEQ ID NO:5, SNP of nucleotide A at position 8 of a sequence comprising at least 80% identity to SEQ ID NO:6, SNP of nucleotide T at position 29 of a sequence comprising at least 80% identity to SEQ ID NO:7, or any combination thereof, associated with resistance to BDM race-0; b. SNP of nucleotide T at position 55 of a sequence comprising at least 80% identity to SEQ ID NO:8, SNP of nucleotide T at position 41 of a sequence comprising at least 80% identity to SEQ ID NO:9, SNP of nucleotide C at position 11 of a sequence comprising at least 80% identity to SEQ ID NO:10, SNP of nucleotide G at position 6 of a sequence comprising at least 80% identity to SEQ ID NO:11 or any combination thereof, associated with resistance to BDM race-1; and c. any combination thereof.
TOMATO PLANT PRODUCING FRUITS WITH MODIFIED SUGAR CONTENT
Applicants: THE STATE OF ISRAEL; SYNGENTA PARTICIPATIONS AG
Abstract: The present invention relates to novel tomato plants producing fruits displaying a modified sugar content, particularly displaying an increased sucrose content. The present invention also relates to seeds and parts of said plants, for example fruits. The present invention further relates to methods of making and using such seeds and plants. The present invention also relates to a novel sucrose modifier SucMod allele, which, when combined with a sucrose accumulation T/Vallele derived from a green-fruited wild tomato accession, significantly alters the proportion of sugar stored in the fruit, confers increased fruit sucrose content at the expense of hexose sugars and results in a fruit with a distinctive flavour.
Independent claims:
22. A cultivated Solanum lycopersicum plant, comprising: a) at least one Sucrose Modifier (SucMod) allele having at least 90% identity with SEQ ID NO: 1, and b) two sucrose accumulation Tomato Vacuolar Invertase (TIV) alleles having at least 98% sequence identity with SEQ ID NO: 6; wherein said SucMod allele comprises a nucleotide G at a position which corresponds to position 310 of SEQ ID NO: 1, and a nucleotide T at a position which corresponds to position 498 of SEQ ID NO: 1, and wherein said plant produces tomato fruit exhibiting an increased sucrose to hexose ratio of at least 50% at red ripe stage when compared with the same cultivated tomato plant lacking said SucMod and TIV alleles.
39. A cultivated Solanum lycopersicum plant, comprising: a) at least one Sucrose Modifier (SucMod) allele comprising the nucleotide sequence of SEQ ID NO: 1, and b) two sucrose accumulation Tomato Vacuolar Invertase (TIV) alleles, each comprising the nucleotide sequence of SEQ ID NO: 6; wherein said plant produces tomato fruit exhibiting an increased sucrose to hexose ratio of at least 50% at red ripe stage compared with the same cultivated tomato plant lacking said SucMod and TIV alleles.
EUSTOMA PLANT WITH EUSTOMA FUSARIUM WILT RESISTANCE
Applicants: TAKII & Co., Ltd
Abstract: The present disclosure provides a Eustoma plant that exhibits resistance to Eustoma fusarium wilt. The Eustoma plant according to the present disclosure is a Eustoma fusarium wilt-resistant Eustoma plant including a Eustoma fusarium wilt resistance locus on chromosome 20.
Independent claim:
1. A Eustoma fusarium wilt-resistant Eustoma plant comprising: a Eustoma fusarium wilt resistance locus on chromosome 20.
BRASSICA RAPA VAR NIPPOSINICA NAMED MAZUNTE
Applicants: VILMORIN-MIKADO USA, INC.
Abstract: Novel Brassica rapa var. nipposinica, such as Brassica rapa var. nipposinica designated MAZUNTE is disclosed. In some embodiments, the invention relates to the seeds of Brassica rapa var. nipposinica MAZUNTE, to the plants and plant parts of Brassica rapa var. nipposinica MAZUNTE, and to methods for producing a Brassica rapa var. nipposinica plant by crossing the Brassica rapa var. nipposinica MAZUNTE with itself or another Brassica rapa var. nipposinica plant. The invention further relates to methods for producing other Brassica rapa var. nipposinica plants derived from the Brassica rapa var. nipposinica MAZUNTE.
Independent claims:
1. A seed of Brassica rapa nipposinica designated MAZUNTE, wherein a representative sample of seed of said Brassica rapa var. nipposinica having been deposited under NCIMB No ______.
4. A Brassica rapa nipposinica plant, having all of the characteristics of Brassica rapa var. nipposinica MAZUNTE listed in Table 1 when grown in the same environmental conditions or a part or a plant cell thereof.
5. A Brassica rapa nipposinica plant, or a part thereof, having all of the physiological and morphological characteristics of Brassica rapa var. nipposinica MAZUNTE, wherein a representative sample of seed of said Brassica rapa var. nipposinica having been deposited under NCIMB No ______.
21. A method of introducing a desired trait into Brassica rapa nipposinica MAZUNTE comprising: (a) crossing a Brassica rapa var. nipposinica MAZUNTE plant grown from Brassica rapa var. nipposinica MAZUNTE seed, wherein a representative sample of seed has been deposited under NCIMB No. ______, with another lettuce plant that comprises a desired trait to produce F.sub.1 progeny plants; (b) selecting one or more progeny plants that have the desired trait to produce selected progeny plants; (c) crossing the selected progeny plants with the Brassica rapa var. nipposinica MAZUNTE plants to produce backcross progeny plants; (d) selecting for backcross progeny plants that have the desired trait and all of the physiological and morphological characteristics of Brassica rapa var. nipposinica MAZUNTE listed in Table 1 when grown in the same environmental conditions to produce selected backcross progeny plants; and (e) repeating steps (c) and (d) three or more times in succession to produce selected fourth or higher backcross progeny plants that comprise the desired trait and all of the physiological and morphological characteristics of Brassica rapa var. nipposinica MAZUNTE listed in Table 1 when grown in the same environmental conditions.
HYBRID CORN PLANT AND SEED A5000
Applicants: Corn Products Development, Inc.
Abstract: The technology disclosed in this specification relates to the development of a new specialty maize hybrid called A5000, which is bred to provide higher amylose content than common dent corn. More specifically, maize hybrid A5000 is an A5 hybrid, having amylose content of at least 50% by weight of the starch. Specialty maize hybrid A5000 improves on prior art A5 variants by having lower moisture content, which produces significant savings in drying costs for farmers.
Independent claims:
1. A seed of hybrid maize variety A5000, representative seed produced by crossing a first plant of variety A511V with a second plant of variety and A513D, wherein representative seed of the varieties and A513D have been deposited under ATCC Accession Numbers ______ and ______, respectively.
8. A method of introducing a heritable trait into hybrid corn variety A5000, the method comprising the steps of: (a) introducing at least said heritable trait into a first inbred corn variety A511V, a second inbred corn variety A513D, or both inbred corn varieties A511V and A513D to produce plants of said inbred corn varieties that heritably carry said heritable trait, wherein said heritable trait is introduced into said inbred corn varieties by backcrossing, wherein said backcrossing is sufficient to produce an inbred corn variety further comprising said heritable trait, and wherein representative seeds of said inbred corn varieties A511V and A513D are deposited under ATCC Accession Nos. ______ and ______, respectively; and (b) producing a plant of hybrid corn variety A5000 further comprising said heritable trait by crossing a plant of said first or said second inbred corn variety that heritably carries said heritable trait with a plant of a different inbred corn variety selected from a group consisting of inbred corn varieties A511V and A513D, or crossing a plant of said first inbred corn variety and a plant of said second inbred corn variety that both heritably carry said heritable trait.
MARIGOLD MALE INBRED LINE DENOMINATED KI3928
Applicants: KEMIN INDUSTRIES, INC.
Abstract: A new and distinct inbred plant of Tagetes erecta named KI3928 and characterized by elevated levels of lutein in hybrids and fertile male flowers with desirable pollen shading characteristics.
Independent claims:
1. Seed of marigold inbred line designated KI3928, or a part of the seed, representative seed of the line having been deposited under ATCC Accession No. PTA-127534.
11. A method for producing a marigold plant, said method comprising the step of: (a) crossing inbred marigold plant KI3928, representative seed of the line having been deposited under ATCC Accession No. PTA-127534, with another marigold line plant to yield progeny marigold seed.
15. A method of introducing a desired trait from marigold inbred line KI3928, representative seed of the line having been deposited under ATCC Accession No. PTA-127534, said method comprising the steps of: (a) crossing KI3928 plants with plants of another marigold line that comprise a desired trait to produce F1 progeny plants; (b) selecting F1 progeny plants that have the desired trait; (c) crossing selected progeny plants with said other marigold line plants to produce backcross progeny plants; (d) selecting for backcross progeny plants that comprise the desired trait and physiological and morphological characteristics of marigold inbred line KI3928; and (e) performing steps (c) and (d) one or more times in succession to produce the selected or higher backcross progeny plants that comprise the desired trait and all of the physiological and morphological characteristics of said other marigold inbred line as determined at the 5% significance level when grown in the same environmental conditions.
22. A genetically engineered marigold plant, or parts thereof, or progeny marigold seed, containing one or more desired trait.
POTATO VARIETY NAMED 'UNR-01'
Applicants: Board of Regents of the Nevada System of Higher Education, on Behalf of the University of Nevada
Abstract: Herein provided is a new potato variety designated ‘UNR-01’ as well as the tubers, seeds, plants, plant parts, and derivatives of the new potato variety ‘UNR-01’. This transgenic variety was generated using CRISPR-Cas9 and deleting a portion of the StMYB93 (PGSC0003DMG400006408) gene. This transgenic variety has a sprout suppressed phenotype that results in a longer storage life in cold storage conditions without the application of sprout-inhibiting chemicals. These potatoes were not impacted in reduced sugar levels, wound healing capacities, and native periderm suberin content. Also provided are tissue cultures of the new potato variety ‘UNR-01’ and the plants regenerated therefrom. Methods for producing potato plants by crossing the new potato variety ‘UNR-01’ with itself or another potato variety and plants produced by such methods are also provided. ‘UNR-01’ potatoes exhibit suppressed sprouting and longer storage life in cold storage conditions without the application of sprout-inhibiting chemicals.
Independent claim:
1. A potato tuber, plant, plantlet, plant part, or plant cell of potato variety ‘UNR-01’, wherein a representative potato tuber, plantlet, or tissue culture of the variety has been deposited under Accession No.
RICE CULTIVAR CLM05
Applicants: The Board of Trustees of the University of Arkansas
Abstract: A rice cultivar designated CLM05 is disclosed herein. The present invention provides seeds, plants, and plant parts derived from rice cultivar CLM05. Further, it provides methods for producing a rice plant by crossing CLM05 with itself or another rice variety. The invention also encompasses any rice seeds, plants, and plant parts produced by the methods disclosed herein, including those in which additional traits have been transferred into CLM05 through the introduction of a transgene or by breeding CLM05 with another rice cultivar.
Independent claims:
1. A rice seed of the cultivar CLM05, a representative sample of seed of said cultivar having been deposited under NCMA Accession No. XXX.
15. A method for combating undesired vegetation or controlling weeds in the vicinity of a rice plant of rice cultivar CLM05, comprising applying an effective amount of at least one AHAS-inhibiting herbicide to the weeds and to the rice plant, a representative sample of seed of said cultivar having been deposited under NCMA Accession No. XXX.
CRAB APPLE TREE NAMED 'B17CRAB7'
*Non Final Action Mailed*
Applicants: University of Guelph
Abstract: A new crab apple tree particularly distinguished by fruit with a distinct ellipsoid conical (ovoid) shape, long pedicel that is red (stem), and range in weight from 20-45 g. The fruit have a predominantly dark red, reddish-purple skin colour and cherry coloured red flesh. When pressed, crimson red juice is extracted that is high in acidity and polyphenols. The tree is moderately vigorous, red leaves at bloom that turn dark green during development. Flowers are pink in color when fully open. The shoots have a distinctly red colour which is clearly distinguishable from other apple cultivars, is disclosed.
Independent claim:
1. A new and distinct variety of crab apple tree designated ‘B17Crab7’ as illustrated and described herein.
|
